DEAF1 Binds Unmethylated and Variably Spaced CpG Dinucleotide Motifs

نویسندگان

  • Philip J. Jensik
  • Jesse D. Vargas
  • Sara N. Reardon
  • Shivakumar Rajamanickam
  • Jodi I. Huggenvik
  • Michael W. Collard
چکیده

DEAF1 is a transcriptional regulator associated with autoimmune and neurological disorders and is known to bind TTCG motifs. To further ascertain preferred DEAF1 DNA ligands, we screened a random oligonucleotide library containing an "anchored" CpG motif. We identified a binding consensus that generally conformed to a repeated TTCGGG motif, with the two invariant CpG dinucleotides separated by 6-11 nucleotides. Alteration of the consensus surrounding the dual CpG dinucleotides, or cytosine methylation of a single CpG half-site, eliminated DEAF1 binding. A sequence within the Htr1a promoter that resembles the binding consensus but contains a single CpG motif was confirmed to have low affinity binding with DEAF1. A DEAF1 binding consensus was identified in the EIF4G3 promoter and ChIP assay showed endogenous DEAF1 was bound to the region. We conclude that DEAF1 preferentially binds variably spaced and unmethylated CpG-containing half-sites when they occur within an appropriate consensus.

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Oligonucleotide containing CpG motifs enhances immune response to mucosally or systemically administered tetanus toxoid.

Oligodeoxynucleotides (ODN) containing unmethylated CpG dinucleotides induce proliferation of B cells and activation of macrophages and thus stimulation of the immune system. We tested an oligonucleotide containing an unmethylated CpG dinucleotide flanked by two 5' purines and two 3' pyrimidines (GAGAACGCTCGACCTTCGAT) for the ability to affect antibody levels to tetanus toxoid (Tt). Groups of m...

متن کامل

Minimal sequence requirements for oligodeoxyribonucleotides activating human TLR9.

Synthetic oligodeoxyribonucleotides (ODNs) containing CpG (unmethylated deoxycytidylyl-deoxyguanosine dinucleotide) motifs activate endosomal TLR9. The nucleotide sequence, length, and dimerization properties of ODNs modulate their activation of TLR9. We performed a systematic investigation of the sequence motifs of B-class and C-class phosphodiester ODNs to identify the sequence properties tha...

متن کامل

Competition by inhibitory oligonucleotides prevents binding of CpG to C-terminal TLR9.

TLR9 recognizes unmethylated CpG-containing DNA commonly found in bacteria. Synthetic oligonucleotides containing CpG-motifs (CpG ODNs) recapitulate the activation of TLR9 by microbial DNA, whereas inversion of the CG dinucleotide within the CpG motif to GC (GpC ODNs) renders such ODNs inactive. This difference cannot be attributed to binding of ODNs to the full-length TLR9 ectodomain, as both ...

متن کامل

Novel oligodeoxynucleotide agonists of TLR9 containing N3-Me-dC or N1-Me-dG modifications

Synthetic oligodeoxynucleotides containing unmethylated CpG motifs activate Toll-Like Receptor 9 (TLR9). Our previous studies have shown the role of hydrogen-bond donor and acceptor groups of cytosine and guanine in the CpG motif and identified synthetic immunostimulatory motifs. In the present study to elucidate the significance of N3-position of cytosine and N1-position of guanine in the CpG ...

متن کامل

Novel oligodeoxynucleotide agonists of TLR9 containing N-Me-dC or N-Me-dG modifications

Synthetic oligodeoxynucleotides containing unmethylated CpG motifs activate Toll-Like Receptor 9 (TLR9). Our previous studies have shown the role of hydrogen-bond donor and acceptor groups of cytosine and guanine in the CpG motif and identified synthetic immunostimulatory motifs. In the present study to elucidate the significance of N3-position of cytosine and N1-position of guanine in the CpG ...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

عنوان ژورنال:

دوره 9  شماره 

صفحات  -

تاریخ انتشار 2014